Workflow Type: Snakemake
Stable

skim2mito

skim2mito is a snakemake pipeline for the batch assembly, annotation, and phylogenetic analysis of mitochondrial genomes from low coverage genome skims. The pipeline was designed to work with sequence data from museum collections. However, it should also work with genome skims from recently collected samples.

Contents

Setup

The pipeline is written in Snakemake and uses conda to install the necessary tools.

It is strongly recommended to install conda using Mambaforge. See details here https://snakemake.readthedocs.io/en/stable/getting_started/installation.html

Once conda is installed, you can pull the github repo and set up the base conda environment.

# get github repo
git clone https://github.com/o-william-white/skim2mito

# change dir
cd skim2mito

# setup conda env
conda env create -n skim2mito_env -f workflow/envs/conda_env.yaml
conda config --set channel_priority flexible

If you need to install the conda environment to a specific location, use the following example, where the prefix argument can be updated to include a specific path:

conda env create -n skim2mito_env --prefix /your_path/skim2mito_env -f workflow/envs/conda_env.yaml


Example data

Before you run your own data, it is recommended to run the example datasets provided. This will confirm there are no user-specific issues with the setup and it also installs all the dependencies. The example data includes simulated mitochondrial data from 25 different butterfly species.

To run the example data, use the code below. Note that you need to change the user email to your own address. The email is required by the Bio Entrez package to fetch reference sequences. The first time you run the pipeline, it will take some time to install each of the conda environments, so it is a good time to take a tea break :).

conda activate skim2mito_env

snakemake --cores 4 --use-conda --config user_email=user@example_email.com

Once this has finished, you can generate a snakemake report using the following command. As above, you need to change the user email to your own address.

snakemake --cores 4 --use-conda --config user_email=user@example_email.com --report skim2mito_report.html


Input

Snakemake requires a config.yaml and samples.csv to define input parameters and sequence data for each sample.

For the example data provided, the config file is located here config/config.yaml and it looks like this:

# path to sample sheet csv with columns for ID,forward,reverse,taxid,seed,gene
samples: config/samples.csv

# user email
user_email: user@example_email.com

# getorganelle reference (go_fetch, custom)
go_reference: go_fetch

# forward adapter
forward_adapter: AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

# reverse adapter
reverse_adapter: AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

# fastp deduplication (True/False)
fastp_dedup: True

# mitos refseq database (refseq39, refseq63f, refseq63m, refseq63o, refseq89f, refseq89m, refseq89o)
mitos_refseq: refseq39

# mito code (2 = Vertebrate, 4 = Mold, 5 = Invertebrate, 9 = Echinoderm, 13 = Ascidian, 14 = Alternative flatworm)
mitos_code: 5

# alignment trimming method to use (gblocks or clipkit)
alignment_trim: gblocks

# alignment missing data threshold for alignment (0.0 - 1.0)
missing_threshold: 0.5

# name of outgroup sample (optional)
# use "NA" if there is no obvious outgroup
# if more than one outgroup use a comma separated list i.e. "sampleA,sampleB"
outgroup: Eurema_blanda

# plot dimensions (cm)
plot_height: 20
plot_width: 20

The example samples.csv file is located here config/samples.csv and it looks like this (note that the seed and gene columns are only required if the custom getorganelle database option is specified in the config file):

ID forward reverse taxid seed gene
Adelpha_iphiclus .test/reads/Adelpha_iphiclus_1.fq.gz .test/reads/Adelpha_iphiclus_2.fq.gz 100750 .test/seed_mitochondrion.fasta .test/gene_mitochondrion.fasta
Anartia_jatrophae_saturata .test/reads/Anartia_jatrophae_saturata_1.fq.gz .test/reads/Anartia_jatrophae_saturata_2.fq.gz 40040 .test/seed_mitochondrion.fasta .test/gene_mitochondrion.fasta
Araschnia_levana .test/reads/Araschnia_levana_1.fq.gz .test/reads/Araschnia_levana_2.fq.gz 40040 .test/seed_mitochondrion.fasta .test/gene_mitochondrion.fasta
Auzakia_danava .test/reads/Auzakia_danava_1.fq.gz .test/reads/Auzakia_danava_2.fq.gz 100750 .test/seed_mitochondrion.fasta .test/gene_mitochondrion.fasta
Baeotus_beotus .test/reads/Baeotus_beotus_1.fq.gz .test/reads/Baeotus_beotus_2.fq.gz 40040 .test/seed_mitochondrion.fasta .test/gene_mitochondrion.fasta
Catacroptera_cloanthe .test/reads/Catacroptera_cloanthe_1.fq.gz .test/reads/Catacroptera_cloanthe_2.fq.gz 40040 .test/seed_mitochondrion.fasta .test/gene_mitochondrion.fasta
Chalinga_pratti .test/reads/Chalinga_pratti_1.fq.gz .test/reads/Chalinga_pratti_2.fq.gz 100750 .test/seed_mitochondrion.fasta .test/gene_mitochondrion.fasta
Diaethria_gabaza_eupepla .test/reads/Diaethria_gabaza_eupepla_1.fq.gz .test/reads/Diaethria_gabaza_eupepla_2.fq.gz 127268 .test/seed_mitochondrion.fasta .test/gene_mitochondrion.fasta
Doleschallia_melana .test/reads/Doleschallia_melana_1.fq.gz .test/reads/Doleschallia_melana_2.fq.gz 40040 .test/seed_mitochondrion.fasta .test/gene_mitochondrion.fasta
Eurema_blanda .test/reads/Eurema_blanda_1.fq.gz .test/reads/Eurema_blanda_2.fq.gz 42450 .test/seed_mitochondrion.fasta .test/gene_mitochondrion.fasta
Hypolimnas_usambara .test/reads/Hypolimnas_usambara_1.fq.gz .test/reads/Hypolimnas_usambara_2.fq.gz 40040 .test/seed_mitochondrion.fasta .test/gene_mitochondrion.fasta
Junonia_villida .test/reads/Junonia_villida_1.fq.gz .test/reads/Junonia_villida_2.fq.gz 40040 .test/seed_mitochondrion.fasta .test/gene_mitochondrion.fasta
Kallima_paralekta .test/reads/Kallima_paralekta_1.fq.gz .test/reads/Kallima_paralekta_2.fq.gz 40040 .test/seed_mitochondrion.fasta .test/gene_mitochondrion.fasta
Kallimoides_rumia .test/reads/Kallimoides_rumia_1.fq.gz .test/reads/Kallimoides_rumia_2.fq.gz 40040 .test/seed_mitochondrion.fasta .test/gene_mitochondrion.fasta
Litinga_cottini .test/reads/Litinga_cottini_1.fq.gz .test/reads/Litinga_cottini_2.fq.gz 100750 .test/seed_mitochondrion.fasta .test/gene_mitochondrion.fasta
Mallika_jacksoni .test/reads/Mallika_jacksoni_1.fq.gz .test/reads/Mallika_jacksoni_2.fq.gz 40040 .test/seed_mitochondrion.fasta .test/gene_mitochondrion.fasta
Moduza_procris .test/reads/Moduza_procris_1.fq.gz .test/reads/Moduza_procris_2.fq.gz 100750 .test/seed_mitochondrion.fasta .test/gene_mitochondrion.fasta
Parasarpa_zayla .test/reads/Parasarpa_zayla_1.fq.gz .test/reads/Parasarpa_zayla_2.fq.gz 100750 .test/seed_mitochondrion.fasta .test/gene_mitochondrion.fasta
Phaedyma_columella .test/reads/Phaedyma_columella_1.fq.gz .test/reads/Phaedyma_columella_2.fq.gz 100750 .test/seed_mitochondrion.fasta .test/gene_mitochondrion.fasta
Precis_pelarga .test/reads/Precis_pelarga_1.fq.gz .test/reads/Precis_pelarga_2.fq.gz 40040 .test/seed_mitochondrion.fasta .test/gene_mitochondrion.fasta
Protogoniomorpha_temora .test/reads/Protogoniomorpha_temora_1.fq.gz .test/reads/Protogoniomorpha_temora_2.fq.gz 40040 .test/seed_mitochondrion.fasta .test/gene_mitochondrion.fasta
Salamis_cacta .test/reads/Salamis_cacta_1.fq.gz .test/reads/Salamis_cacta_2.fq.gz 40040 .test/seed_mitochondrion.fasta .test/gene_mitochondrion.fasta
Smyrna_blomfildia .test/reads/Smyrna_blomfildia_1.fq.gz .test/reads/Smyrna_blomfildia_2.fq.gz 40040 .test/seed_mitochondrion.fasta .test/gene_mitochondrion.fasta
Tacola_larymna .test/reads/Tacola_larymna_1.fq.gz .test/reads/Tacola_larymna_2.fq.gz 100750 .test/seed_mitochondrion.fasta .test/gene_mitochondrion.fasta
Yoma_algina .test/reads/Yoma_algina_1.fq.gz .test/reads/Yoma_algina_2.fq.gz 40040 .test/seed_mitochondrion.fasta .test/gene_mitochondrion.fasta


Output

All output files are saved to the results direcotry. Below is a table summarising all of the output files generated by the pipeline.

Directory Description
fastqc_raw Fastqc reports for raw input reads
fastp Fastp reports from quality control of raw reads
fastqc_qc Fastqc reports for quality controlled reads
go_fetch Optional output containing reference databasesused by GetOrganelle
getorganelle GetOrganelle output with a directory for each sample
assembled_sequence Assembled sequences selected from GetOrganelle output and renamed
seqkit Seqkit summary of each assembly
blastn Blastn output of each assembly
minimap Mapping output of quality filtered reads against each assembly
blobtools Blobtools assembly summary collating blastn and mapping output
assess_assembly Plots of annotations, mean depth, GC content and proportion mismatches
annotations Annotation outputs of mitos
summary Summary per sample (seqkit stats), contig (GC content, length, coverage, taxonomy and annotations) and annotated gene counts
annotated_genes Unaligned fasta files of annotated genes identified across all samples
mafft Mafft aligned fasta files of annotated genes identified across all samples
mafft_filtered Mafft aligned fasta files after the removal of sequences based on a missing data threshold
alignment_trim Ambiguous parts of alignment removed using either gblocks or clipkit
iqtree Iqtree phylogenetic analysis of annotated genes
plot_tree Plots of phylogenetic trees
multiqc Multiqc summary report


Filtering contaminants

If you are working with museum collections, it is possible that you may assemble and annotate sequences from contaminant/non-target species. Contaminant sequences can be identified based on the blast search output or unusual placement in the phylogenetic trees (see blobtools and plot_tree outputs).

A supplementary python script format_alignments.py is provided to remove putative contaminants from alignments, and format the alignments for downstream phylogenetic analysis.

For example, let's say we wanted to remove all sequences from the sample "Kallima_paralekta" and atp6 gene sequences, you could run the script as shown below. The script works by identifying and removing sequences that have names with Kallima_paralekta or atp6 in the sequence names. The filtered alignments are written to a new output directory filter_alignments_output.

python workflow/scripts/format_alignments.py  \
   --input results/mafft_filtered/ \
   --cont Kallima_paralekta atp6 \
   --output filter_alignments_output

Note that the output fasta files have been reformatted so each alignment file is named after the gene and each sequence is named after the sample. This is useful if you would like to run our related pipeline gene2phylo for further phylogenetic analyses.



Assembly and annotation only

If you are only interested in the assembly of mitochondrial sequences and annotation of genes without the phylogenetic analysis, you can stop the pipeline from running the gene alignment and phylogenetic analyses using the --omit-from parameter.

snakemake --cores 4 --use-conda --config user_email=user@example_email.com --omit-from mafft


Running your own data

The first thing you need to do is generate your own config.yaml and samples.csv files, using the files provided as a template.

GetOrganelle requires reference data in the format of seed and gene reference fasta files. By default the pipeline uses a basic python script called go_fetch.py https://github.com/o-william-white/go_fetch to download and format reference data formatted for GetOrganelle.

go_fetch.py works by searching NCBI based on the NCBI taxonomy specified by the taxid column in the samples.csv file. Note that the seed and gene columns in the samples.csv file are only required if you want to provide your own custom GetOrganelle seed and gene reference databases.

You can use the default reference data for GetOrganelle, but I would recommend using custom reference databases where possible. See here for details of how to set up your own databases https://github.com/Kinggerm/GetOrganelle/wiki/FAQ#how-to-assemble-a-target-organelle-genome-using-my-own-reference

Getting help

If you have any questions, please do get in touch in the issues or by email o.william.white@gmail.com



Citations

If you use the pipeline, please cite our bioarxiv preprint: https://doi.org/10.1101/2023.08.11.552985

Since the pipeline is a wrapper for several other bioinformatic tools we also ask that you cite the tools used by the pipeline:



Version History

main @ a63288c (latest) Created 7th Oct 2024 at 13:24 by Oliver White

Merge pull request #34 from SchistoDan/main

Update go_fetch.py


Frozen main a63288c

main @ 34ef5b6 (earliest) Created 12th Mar 2024 at 15:03 by Oliver White

Min version


Frozen main 34ef5b6
help Creators and Submitter
Creators
Not specified
Submitter
License
Activity

Views: 863   Downloads: 178

Created: 12th Mar 2024 at 15:03

Last updated: 7th Oct 2024 at 13:24

help Attributions

None

Total size: 5.28 MB
Powered by
(v.1.16.0-main)
Copyright © 2008 - 2024 The University of Manchester and HITS gGmbH