rnaseq-sr/main

View on GitHub Download RO-Crate Run on Galaxy
Workflow Type: Galaxy

This workflow takes as input a list of single-read fastqs. Adapters and bad quality bases are removed with cutadapt. Reads are mapped with STAR with ENCODE parameters and genes are counted simultaneously. The counts are reprocess to be similar to HTSeq-count output. FPKM are computed with cufflinks. Coverage (per million mapped reads) are computed with bedtools on uniquely mapped reads.

SEEK ID: https://workflowhub.eu/workflows/400?version=4

Inputs

ID Name Description Type
SR fastq input SR fastq input Should be a list of single-read RNA-seq fastqs
  • File[]
forward_adapter forward_adapter Please use: For R1: - For Nextera: CTGTCTCTTATACACATCTCCGAGCCCACGAGAC - For TrueSeq: GATCGGAAGAGCACACGTCTGAACTCCAGTCAC or AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC
  • string
gtf gtf gtf compatible with the reference_genome. Mind the UCSC/Ensembl differences in chromosome naming
  • File
gtf with regions to exclude from FPKM normalization gtf with regions to exclude from FPKM normalization Could be a gtf with for example one entry for the chrM forward and one entry for the chrM reverse
  • File?
reference_genome reference_genome reference_genome
  • string
strandness strandness For stranded RNA, reverse means that the read is complementary to the coding sequence, forward means that the read is in the same orientation as the coding sequence
  • string

Steps

ID Name Description
6 Cutadapt (remove adapter + bad quality bases) toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/4.0+galaxy1
7 get reference_genome as text parameter toolshed.g2.bx.psu.edu/repos/iuc/compose_text_param/compose_text_param/0.1.1
8 awk command from strand toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.1.1
9 bedtools orientation for forward coverage toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.1.1
10 bedtools orientation for reverse coverage toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.1.1
11 Get cufflinks strandess parameter toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.1.1
12 STAR: map and count toolshed.g2.bx.psu.edu/repos/iuc/rgrnastar/rna_star/2.7.8a+galaxy1
13 MultiQC toolshed.g2.bx.psu.edu/repos/iuc/multiqc/multiqc/1.11+galaxy1
14 Extract gene counts toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_awk_tool/1.1.2
15 Keep only uniquely mapped reads toolshed.g2.bx.psu.edu/repos/devteam/bamtools_filter/bamFilter/2.5.2+galaxy1
16 get scaling factor This step get 1 / millions of uniquely mapped reads toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_awk_tool/1.1.2
17 Compute FPKM toolshed.g2.bx.psu.edu/repos/devteam/cufflinks/cufflinks/2.2.1.3
18 convert dataset to parameter param_value_from_file
19 Scaled Coverage both strands combined toolshed.g2.bx.psu.edu/repos/iuc/bedtools/bedtools_genomecoveragebed/2.30.0
20 Scaled Coverage positive toolshed.g2.bx.psu.edu/repos/iuc/bedtools/bedtools_genomecoveragebed/2.30.0
21 Scaled Coverage negative toolshed.g2.bx.psu.edu/repos/iuc/bedtools/bedtools_genomecoveragebed/2.30.0
22 convert both strands coverage to bigwig wig_to_bigWig
23 convert positive coverage to bigwig wig_to_bigWig
24 convert negative coverage to bigwig wig_to_bigWig

Outputs

ID Name Description Type
output_log output_log n/a
  • File
reads_per_gene from STAR reads_per_gene from STAR n/a
  • File
mapped-reads mapped-reads n/a
  • File
MultiQC webpage MultiQC webpage n/a
  • File
MultiQC on input dataset(s): Stats MultiQC on input dataset(s): Stats n/a
  • File
HTS count like output HTS count like output n/a
  • File
transcripts_expression transcripts_expression n/a
  • File
genes_expression genes_expression n/a
  • File
both strands coverage both strands coverage n/a
  • File
positive strand coverage positive strand coverage n/a
  • File
negative strand coverage negative strand coverage n/a
  • File

Version History

v1.0 (latest) Created 20th Nov 2024 at 03:02 by WorkflowHub Bot

Updated to v1.0


Frozen v1.0 96e4475

v0.9 Created 7th Oct 2024 at 16:32 by WorkflowHub Bot

Updated to v0.9


Frozen v0.9 26e44e5

v0.6 Created 7th Oct 2024 at 16:32 by WorkflowHub Bot

Updated to v0.6


Frozen v0.6 2465702

v0.8 Created 16th Jul 2024 at 03:02 by WorkflowHub Bot

Updated to v0.8


Frozen v0.8 ee9034e

v0.7 Created 29th Jun 2024 at 03:02 by WorkflowHub Bot

Updated to v0.7


Frozen v0.7 59f2b7e

v0.5 Created 16th Sep 2023 at 03:01 by WorkflowHub Bot

Updated to v0.5


Frozen v0.5 ac353d9

v0.4.1 Created 15th Sep 2023 at 03:01 by WorkflowHub Bot

Updated to v0.4.1


Frozen v0.4.1 5228c14

v0.4 Created 17th Jan 2023 at 03:01 by WorkflowHub Bot

Updated to v0.4


Frozen v0.4 f49c5a7

v0.2 Created 1st Dec 2022 at 03:01 by WorkflowHub Bot

Updated to v0.2


Frozen v0.2 28b9493

v0.1 (earliest) Created 22nd Oct 2022 at 03:01 by WorkflowHub Bot

Updated to v0.1


Frozen v0.1 30a19f3
help Creators and Submitter
Creator
  • Lucille Delisle
Additional credit

Lucille Delisle

Submitter
Tools
STAR
MultiQC
Cufflinks
License
MIT License
Activity

Views: 5014   Downloads: 1125   Runs: 0

Created: 22nd Oct 2022 at 03:01

Last updated: 17th Jan 2023 at 03:01

help Tags
help Attributions

None

Total size: 65.6 KB
Powered by
 (v.1.16.0-main)
About WorkflowHub | Acknowledgements | Credits | Terms & Conditions | Privacy Policy | Cite us | Contact us
Copyright © 2008 - 2024 The University of Manchester and HITS gGmbH