rnaseq-sr/main
View on GitHub
Download RO Crate
Run on usegalaxy.eu
Workflow Type: Galaxy
Frozen
Tests This workflow takes as input a list of single-read fastqs. Adapters and bad quality bases are removed with cutadapt. Reads are mapped with STAR with ENCODE parameters and genes are counted simultaneously. The counts are reprocess to be similar to HTSeq-count output. FPKM are computed with cufflinks. Coverage (per million mapped reads) are computed with bedtools on uniquely mapped reads.
Inputs
| ID | Name | Description | Type |
|---|---|---|---|
| SR fastq input | SR fastq input | Should be a list of single-read RNA-seq fastqs |
|
| forward_adapter | forward_adapter | Please use: For R1: - For Nextera: CTGTCTCTTATACACATCTCCGAGCCCACGAGAC - For TrueSeq: GATCGGAAGAGCACACGTCTGAACTCCAGTCAC or AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC |
|
| gtf | gtf | gtf compatible with the reference_genome. Mind the UCSC/Ensembl differences in chromosome naming |
|
| gtf with regions to exclude from FPKM normalization | gtf with regions to exclude from FPKM normalization | Could be a gtf with for example one entry for the chrM forward and one entry for the chrM reverse |
|
| reference_genome | reference_genome | reference_genome |
|
| strandness | strandness | For stranded RNA, reverse means that the read is complementary to the coding sequence, forward means that the read is in the same orientation as the coding sequence |
|
Steps
| ID | Name | Description |
|---|---|---|
| 6 | Cutadapt (remove adapter + bad quality bases) | toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/4.0+galaxy1 |
| 7 | get reference_genome as text parameter | toolshed.g2.bx.psu.edu/repos/iuc/compose_text_param/compose_text_param/0.1.1 |
| 8 | awk command from strand | toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.1.1 |
| 9 | bedtools orientation for forward coverage | toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.1.1 |
| 10 | bedtools orientation for reverse coverage | toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.1.1 |
| 11 | Get cufflinks strandess parameter | toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.1.1 |
| 12 | STAR: map and count | toolshed.g2.bx.psu.edu/repos/iuc/rgrnastar/rna_star/2.7.8a+galaxy1 |
| 13 | MultiQC | toolshed.g2.bx.psu.edu/repos/iuc/multiqc/multiqc/1.11+galaxy1 |
| 14 | Extract gene counts | toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_awk_tool/1.1.2 |
| 15 | Keep only uniquely mapped reads | toolshed.g2.bx.psu.edu/repos/devteam/bamtools_filter/bamFilter/2.5.2+galaxy1 |
| 16 | get scaling factor | This step get 1 / millions of uniquely mapped reads toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_awk_tool/1.1.2 |
| 17 | Compute FPKM | toolshed.g2.bx.psu.edu/repos/devteam/cufflinks/cufflinks/2.2.1.3 |
| 18 | convert dataset to parameter | param_value_from_file |
| 19 | Scaled Coverage both strands combined | toolshed.g2.bx.psu.edu/repos/iuc/bedtools/bedtools_genomecoveragebed/2.30.0 |
| 20 | Scaled Coverage positive | toolshed.g2.bx.psu.edu/repos/iuc/bedtools/bedtools_genomecoveragebed/2.30.0 |
| 21 | Scaled Coverage negative | toolshed.g2.bx.psu.edu/repos/iuc/bedtools/bedtools_genomecoveragebed/2.30.0 |
| 22 | convert both strands coverage to bigwig | wig_to_bigWig |
| 23 | convert positive coverage to bigwig | wig_to_bigWig |
| 24 | convert negative coverage to bigwig | wig_to_bigWig |
Outputs
| ID | Name | Description | Type |
|---|---|---|---|
| output_log | output_log | n/a |
|
| reads_per_gene from STAR | reads_per_gene from STAR | n/a |
|
| mapped-reads | mapped-reads | n/a |
|
| MultiQC webpage | MultiQC webpage | n/a |
|
| MultiQC on input dataset(s): Stats | MultiQC on input dataset(s): Stats | n/a |
|
| HTS count like output | HTS count like output | n/a |
|
| transcripts_expression | transcripts_expression | n/a |
|
| genes_expression | genes_expression | n/a |
|
| both strands coverage | both strands coverage | n/a |
|
| positive strand coverage | positive strand coverage | n/a |
|
| negative strand coverage | negative strand coverage | n/a |
|
Version History
v0.1 (earliest) Created 22nd Oct 2022 at 03:01 by WorkflowHub Bot
Updated to v0.1
Frozen
v0.130a19f3
Creators and SubmitterLicense
Activity
Views: 2156
Created: 22nd Oct 2022 at 03:01
Last updated: 17th Jan 2023 at 03:01
Tags AttributionsNone
Related items
Advanced People list for this Workflow with search and filtering
Teams: iwc, Vertebrate Genomes Pipelines in Galaxy
Organizations: Bots, European Galaxy Team
Advanced Teams list for this Workflow with search and filtering
IWC - Intergalactic Workflow Commission
Space: This Team is not associated with a Space
Public web page: https://github.com/galaxyproject/iwc
