Workflow Type: Galaxy

This workflow takes as input a list of paired-end fastqs. Adapters and bad quality bases are removed with cutadapt. Reads are mapped with STAR with ENCODE parameters and genes are counted simultaneously as well as normalized coverage (per million mapped reads) on uniquely mapped reads. The counts are reprocessed to be similar to HTSeq-count output. FPKM are computed with cufflinks and/or with StringTie. The unstranded normalized coverage is computed with bedtools.

Inputs

ID Name Description Type
PE fastq input PE fastq input Should be a list of paired-end RNA-seq fastqs
  • File[]
cufflinks_FPKM cufflinks_FPKM Whether FPKM values should be computed with cufflinks
  • boolean
forward_adapter forward_adapter Please use: For R1: - For Nextera: CTGTCTCTTATACACATCTCCGAGCCCACGAGAC - For TrueSeq: GATCGGAAGAGCACACGTCTGAACTCCAGTCAC or AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC
  • string
gtf gtf gtf compatible with the reference_genome. Mind the UCSC/Ensembl differences in chromosome naming
  • File
gtf with regions to exclude from FPKM normalization with Cufflinks gtf with regions to exclude from FPKM normalization with Cufflinks Could be a gtf with for example one entry for the chrM forward and one entry for the chrM reverse
  • File?
reference_genome reference_genome reference_genome
  • string
reverse_adapter reverse_adapter Please use: For R2: - For Nextera: CTGTCTCTTATACACATCTGACGCTGCCGACGA - For TruSeq: GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT or AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT
  • string
strandedness strandedness For stranded RNA, reverse means that the read is complementary to the coding sequence, forward means that the read is in the same orientation as the coding sequence
  • string
stringtie_FPKM stringtie_FPKM Whether FPKM values should be computed with StringTie
  • boolean

Steps

ID Name Description
9 Cutadapt (remove adapter + bad quality bases) toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/4.4+galaxy0
10 get reference_genome as text parameter toolshed.g2.bx.psu.edu/repos/iuc/compose_text_param/compose_text_param/0.1.1
11 awk command from strand toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.1.1
12 Get cufflinks strandess parameter toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.1.1
13 Get Stringtie strandedness parameter toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.1.1
14 STAR: map and count and coverage splitted toolshed.g2.bx.psu.edu/repos/iuc/rgrnastar/rna_star/2.7.10b+galaxy4
15 MultiQC toolshed.g2.bx.psu.edu/repos/iuc/multiqc/multiqc/1.11+galaxy1
16 Get Uniquely mapped unstranded coverage n/a
17 Re-arrange Stranded RNA-seq coverage n/a
18 Compute FPKM with cufflinks toolshed.g2.bx.psu.edu/repos/devteam/cufflinks/cufflinks/2.2.1.3
19 Extract gene counts toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_awk_tool/1.1.2
20 Compute FPKM with StringTie toolshed.g2.bx.psu.edu/repos/iuc/stringtie/stringtie/2.2.1+galaxy1

Outputs

ID Name Description Type
output_log output_log n/a
  • File
reads_per_gene from STAR reads_per_gene from STAR n/a
  • File
mapped-reads mapped-reads n/a
  • File
MultiQC webpage MultiQC webpage n/a
  • File
MultiQC on input dataset(s): Stats MultiQC on input dataset(s): Stats n/a
  • File
both strands coverage both strands coverage n/a
  • File
stranded coverage stranded coverage n/a
  • File
transcripts_expression_cufflinks transcripts_expression_cufflinks n/a
  • File
genes_expression_cufflinks genes_expression_cufflinks n/a
  • File
HTS count like output HTS count like output n/a
  • File
genes_expression_stringtie genes_expression_stringtie n/a
  • File

Version History

v0.5 (latest) Created 16th Sep 2023 at 03:01 by WorkflowHub Bot

Updated to v0.5


Frozen v0.5 93a3560

v0.4.1 Created 15th Sep 2023 at 03:01 by WorkflowHub Bot

Updated to v0.4.1


Frozen v0.4.1 7acbe8e

v0.4 Created 17th Jan 2023 at 03:01 by WorkflowHub Bot

Updated to v0.4


Frozen v0.4 387b362

v0.3 Created 14th Jan 2023 at 03:01 by WorkflowHub Bot

Updated to v0.3


Frozen v0.3 a0b796b

v0.2 Created 1st Dec 2022 at 03:01 by WorkflowHub Bot

Updated to v0.2


Frozen v0.2 61f6547

v0.1 (earliest) Created 25th Oct 2022 at 03:01 by WorkflowHub Bot

Updated to v0.1


Frozen v0.1 4c67dcd
help Creators and Submitter
Creator
  • Lucille Delisle
Additional credit

Lucille Delisle

Submitter
License
Activity

Views: 1766

Created: 25th Oct 2022 at 03:01

Last updated: 17th Jan 2023 at 03:01

help Tags
help Attributions

None

Total size: 100 KB
Powered by
(v.1.14.1)
Copyright © 2008 - 2023 The University of Manchester and HITS gGmbH