Workflow Type: Galaxy

This workflow take as input a collection of paired fastq. Remove adapters with cutadapt, map pairs with bowtie2 allowing dovetail. Keep MAPQ30 and concordant pairs. BAM to BED. MACS2 with "ATAC" parameters.

Inputs

ID Name Description Type
PE fastq input PE fastq input Should be a paired collection with CUT and RUN fastqs
  • File[]
adapter_forward adapter_forward Please use: For R1: - For TrueSeq (CUT and RUN): GATCGGAAGAGCACACGTCTGAACTCCAGTCAC or AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC - For Nextera (CUT and TAG): CTGTCTCTTATACACATCTCCGAGCCCACGAGAC
  • string
adapter_reverse adapter_reverse Please use: For R2: - For TruSeq (CUT and RUN): GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT or AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT - For Nextera (CUT and TAG): CTGTCTCTTATACACATCTGACGCTGCCGACGA
  • string
effective_genome_size effective_genome_size Used by MACS2: H. sapiens: 2700000000, M. musculus: 1870000000, D. melanogaster: 120000000, C. elegans: 90000000
  • int
reference_genome reference_genome reference_genome
  • string

Steps

ID Name Description
5 Cutadapt (remove adapter + bad quality bases) toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/4.0+galaxy1
6 Bowtie2 map on reference toolshed.g2.bx.psu.edu/repos/devteam/bowtie2/bowtie2/2.5.0+galaxy0
7 filter MAPQ30 concordant pairs toolshed.g2.bx.psu.edu/repos/devteam/samtool_filter2/samtool_filter2/1.8+galaxy1
8 remove PCR duplicates toolshed.g2.bx.psu.edu/repos/devteam/picard/picard_MarkDuplicates/2.18.2.3
9 convert BAM to BED to improve peak calling toolshed.g2.bx.psu.edu/repos/iuc/bedtools/bedtools_bamtobed/2.30.0+galaxy2
10 Call Peaks with MACS2 toolshed.g2.bx.psu.edu/repos/iuc/macs2/macs2_callpeak/2.2.7.1+galaxy0
11 summary of MACS2 toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_grep_tool/1.1.1
12 Bigwig from MACS2 wig_to_bigWig
13 MultiQC toolshed.g2.bx.psu.edu/repos/iuc/multiqc/multiqc/1.11+galaxy1

Outputs

ID Name Description Type
Mapping stats Mapping stats n/a
  • File
MarkDuplicates metrics MarkDuplicates metrics n/a
  • File
BAM filtered rmDup BAM filtered rmDup n/a
  • File
MACS2 peaks xls MACS2 peaks xls n/a
  • File
MACS2 summits MACS2 summits n/a
  • File
MACS2 narrowPeak MACS2 narrowPeak n/a
  • File
MACS2 report MACS2 report n/a
  • File
Coverage from MACS2 (bigwig) Coverage from MACS2 (bigwig) n/a
  • File
MultiQC webpage MultiQC webpage n/a
  • File
MultiQC on input dataset(s): Stats MultiQC on input dataset(s): Stats n/a
  • File

Version History

v0.3 (latest) Created 21st Jan 2023 at 03:01 by WorkflowHub Bot

Updated to v0.3


Frozen v0.3 0a4bf84

v0.2 Created 30th Nov 2022 at 03:01 by WorkflowHub Bot

Updated to v0.2


Frozen v0.2 e5de5e1

v0.1 (earliest) Created 20th Oct 2022 at 03:01 by WorkflowHub Bot

Updated to v0.1


Frozen v0.1 308e6ab
help Creators and Submitter
Creator
  • Lucille Delisle
Additional credit

Lucille Delisle

Submitter
License
Activity

Views: 204

Created: 20th Oct 2022 at 03:01

Last updated: 21st Jan 2023 at 03:01

help Tags
help Attributions

None

Total size: 20.6 MB

Brought to you by:

Powered by
(v.1.13.0)
Copyright © 2008 - 2023 The University of Manchester and HITS gGmbH