ABC MD Setup pipeline using BioExcel Building Blocks (biobb)
Version 1

Workflow Type: Jupyter
Stable

This BioExcel Building Blocks library (BioBB) workflow provides a pipeline to setup DNA structures for the Ascona B-DNA Consortium (ABC) members. It follows the work started with the NAFlex tool to offer a single, reproducible pipeline for structure preparation, ensuring reproducibility and coherence between all the members of the consortium. The NAFlex pipeline was used for the preparation of all the simulations done in the study: The static and dynamic structural heterogeneities of B-DNA: extending Calladine–Dickerson rules. The workflow included in this Jupyter Notebook is extending and updating the NAFlex pipeline, following the best practices exposed by the Daniel R. Roe and Bernard R. Brooks work, and is being used for the new ABC study.

The setup process is performed using the biobb_amber module from the BioBB library, which is wrapping the AMBER MD package. The forcefield used is the nucleic acids specific parmbsc1 forcefield, with Joung & Cheatham monovalent ion parameters for Ewald and TIP4P/EW water and SPC/E Water model.

Parameters

Inputs

Parameters needed to configure the workflow:

  • DNA sequence: Nucleotide sequence to be modelled and prepared for a MD simulation (e.g. GCGCGGCTGATAAACGAAAGC)
  • Forcefield: Forcefield to be used in the setup (e.g. protein.ff14SB).
  • Water model: Water model to be used in the setup (e.g. SPC/E).
  • Ion model: Ion model to be used in the setup (e.g. Dang).
  • Thermostat: Thermostat to be used in the setup (e.g. Langevin).
  • Timestep: Simulation timestep (e.g 2fs).

Outputs

Output files generated (named according to the input parameters given above):

  • output_md_traj_path: Final trajectory of the MD setup protocol (netcdf).
  • output_ions_top_path: Final topology of the MD system.
  • dna_leap_top_4fs_path: Final topology of the MD system with hydrogen mass repartition (allowing 4fs timestep).
  • output_md_rst_path: Final restart file of the MD setup protocol (ncrst).
help Creators and Submitter
Citation
Bayarri, G., & Hospital, A. (2021). ABC MD Setup pipeline using BioExcel Building Blocks (biobb). WorkflowHub. https://doi.org/10.48546/WORKFLOWHUB.WORKFLOW.196.1
Activity

Views: 82   Downloads: 2

Created: 28th Sep 2021 at 14:24

Last used: 16th Oct 2021 at 16:08

help Tags

This item has not yet been tagged.

help Attributions

None

Version History

Version 1 Created 28th Sep 2021 at 14:24 by Genís Bayarri

Initial commit. Taken from Git commit 39c0aee

Related items

Powered by
(v.1.12.0-master)
Copyright © 2008 - 2021 The University of Manchester and HITS gGmbH